SubtiBank SubtiBank
ribR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ribR

riboflavin kinase with preference for dihydroriboflavin, binds FMN riboswitches of the rib operon and of ribU to allow expression even in the presence of FMN, required for the conversion of S-methyl-cysteine to cysteine
locus
BSU_29300
pI
9.28
mw
26.08 kDa
protein length
230 aa Sequence Blast
gene length
693 bp Sequence Blast
function
utilization of S-methyl-cysteine, regulation of rib operon expression
product
riboflavin kinase with preference for dihydroriboflavin
essential
no
synonyms
ytnK,rbfK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.1|Conversion of S-methyl cysteine to cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,000,985 3,001,677

    Phenotypes of a mutant

  • no growth with S-methyl cysteine [Pubmed|23944997]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of FMNH2 [Pubmed|26494285]
  • binds the [SW|FMN riboswitch] [Pubmed|26494285]
  • prevents transcription termination of the ''[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]'' operon even in the presence of FMN or FMNH2 [Pubmed|26494285]
  • prevents sequestration of the ribosome binding site of the ''[gene|651C370386E9FB45E3B98001800D342FEDB43E9A|ribU]'' mRNA even in the presence of FMN or FMNH2 [Pubmed|26494285]
  • ATP + riboflavin --> ADP + FMN + H+ (according to UniProt)
  • Protein family

  • RibR family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|85E732993186528CF58FECFFE89C8F39D278F28D|RibC]:
  • Expression and Regulation

    Operons

    genes
    [gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
    description
    [Pubmed|15668000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A154 (ribR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/154 NBRP B. subtilis, Japan]
  • BKE29300 ([gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT, downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA
  • BKK29300 ([gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAAGTCAGCCTCCTCT, downstream forward: _UP4_GGATAGGGAAAGGAGCGGAA
  • References

  • 17590224,15668000,16109943,15272571,23944997,11390694,26494285