SubtiBank SubtiBank
yukD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yukD

Ubiquitin-like protein, part of the type VII protein secretion system [protein|3CC3E197848E9688413C15CEA7DDCF0A7120A920|YukD]-[protein|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|YukC]-[protein|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|YukB]-[protein|0A38B2E900532C9950DE6E629F5EB21D64E18B55|YueB]-[protein|DA52C4CD130F32734E01A52F2F395127D2260F61|YueC], putative bacteriocin
locus
BSU_31900
pI
6.31
mw
8.94 kDa
protein length
gene length
240 bp Sequence Blast
function
export of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|YukE]
product
ubiquitin-like protein, part of the type VII protein secretion system, putative bacteriocin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.16|Biosynthesis of antibacterial compounds/ based on similarity]
  • Gene

    Coordinates
    3,275,832 3,276,071

    Phenotypes of a mutant

  • loss of secretion of [protein|50D2A03E2D7B5D461540FD157377E0D37F771888|YukE] [Pubmed|24798022]
  • The protein

    Protein family

  • EsaB family (single member, according to UniProt)
  • Structure

  • [PDB|2BPS]
  • Expression and Regulation

    Operons

    genes
    [gene|50D2A03E2D7B5D461540FD157377E0D37F771888|yukE]-[gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]-[gene|3FE4A91C7D0B43C8704391F2F9493852B3AED9B0|yukC]-[gene|6007664F3D979B4D8D4662C7F6E5CF2F489268E3|yukB]-[gene|0A38B2E900532C9950DE6E629F5EB21D64E18B55|yueB]-[gene|DA52C4CD130F32734E01A52F2F395127D2260F61|yueC]-[gene|B258CA26B0EC2310475FCCD67F1F196857FC0004|yueD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|23861817], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expressed in the stationary phase [Pubmed|23861817]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A627 (yukD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/627 NBRP B. subtilis, Japan]
  • BKE31900 ([gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAGGATCACCCTTACA, downstream forward: _UP4_ATATTATGAAAGGATCTGGT
  • BKK31900 ([gene|3CC3E197848E9688413C15CEA7DDCF0A7120A920|yukD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAGGATCACCCTTACA, downstream forward: _UP4_ATATTATGAAAGGATCTGGT
  • References

    Reviews

  • 19155186,11973144
  • Original publications

  • 15576783,16845009,22383849,23861817,15978580,24798022