SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


[SW|RNA polymerase ][SW|sporulation ]mother cell-specific (early) [SW|sigma factor ]SigE
27.55 kDa
protein length
239 aa Sequence Blast
gene length
720 bp Sequence Blast
transcription of [SW|sporulation ]genes (early mother cell)
[SW|RNA polymerase ][SW|sporulation ]mother cell-specific (early) [SW|sigma factor ]SigE

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    1,604,771 1,605,490

    The protein

    Catalyzed reaction/ biological activity

  • [SW|RNA polymerase] [SW|sigma factor], active in the mother cell
  • Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • Structure

  • [PDB|1L0O] ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] in complex with [protein|C8B867758330355F44C63CC284DC7AA3061FB9F1|SpoIIAB], Geobacillus stearothermophilus, 33% identity) [pubmed|11955433]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2512576], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1902213], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|8288522,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[SW|spoIIGA]'': expressed under conditions that trigger sporulation ([SW|Spo0A]) [,15687200 PubMed]
  • additional information

  • the mRNA half-life is about 2.6 min [PubMed|24163345]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • BKE15320 ([gene|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCCTCTCCCTTCTAA, downstream forward: _UP4_TAAAAAATTTTATGGTTAGA
  • BKK15320 ([gene|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCCTCTCCCTTCTAA, downstream forward: _UP4_TAAAAAATTTTATGGTTAGA
  • labs

  • [SW|Bill Haldenwang], San Antonio, USA
  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 20833318,31350897
  • The [SW|SigE regulon]

  • 12662922,15383836,14523133
  • Original Publications

  • 7768847,8002606,8449878,10438769,9922240,10869437,13129963,7585939,1729246,9244279,11849534,8231808,8171000,15547282,15882622,9537362,1542693,1946462,8550479,10498732,15978076,9006059,2115864,7473719,12644503,2115871,15028683,7601832,9150232,1624450,1744037,1400231,2495274,11886548,2514119,1744038,14523132,18436644,8288522,15687200,25835496,23169620,21362630,20802044,21478340,11955433