SubtiBank SubtiBank
hepT [2018-12-07 16:11:21]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hepT [2018-12-07 16:11:21]

heptaprenyl diphosphate synthase component II
39.36 kDa
protein length
348 aa Sequence Blast
gene length
1044 bp Sequence Blast
menaquinone biosynthesis
heptaprenyl diphosphate synthase component II (together with [protein|C45A5935559F0DAAD70F808725AF730BC18A2B0A|HepS])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of menaquinone]
  • Gene

    2,381,919 → 2,382,965

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • All-trans-hexaprenyl diphosphate + isopentenyl diphosphate = diphosphate + all-trans-heptaprenyl diphosphate (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|YqiD]
  • Structure

  • [PDB|5H9D] (from Staphylococcus aureus, 47% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE22740 (Δ[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • BKK22740 (Δ[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • References

  • 12682299,9720033,28189581