SubtiBank SubtiBank
hepT [2018-12-07 16:05:54]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hepT [2018-12-07 16:05:54]

heptaprenyl diphosphate synthase component II
39.36 kDa
protein length
348 aa Sequence Blast
gene length
1044 bp Sequence Blast
menaquinone biosynthesis
heptaprenyl diphosphate synthase component II (together with HepS)
gerCC, hepB, gerC58

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of menaquinone]
  • Gene

    2,381,919 → 2,382,965

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • All-trans-hexaprenyl diphosphate + isopentenyl diphosphate = diphosphate + all-trans-heptaprenyl diphosphate (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|YqiD]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE22740 (Δ[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • BKK22740 (Δ[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • References

  • 12682299,9720033,28189581