SubtiBank SubtiBank
hepT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

hepT

heptaprenyl diphosphate synthase component II
locus
BSU_22740
pI
6.28
mw
39.36 kDa
protein length
348 aa Sequence Blast
gene length
1047 bp Sequence Blast
function
menaquinone biosynthesis
product
heptaprenyl diphosphate synthase component II (together with [protein|C45A5935559F0DAAD70F808725AF730BC18A2B0A|HepS])
essential
no
ec
2.5.1.30
synonyms
gerCC,hepB,gerC58

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.8|Biosynthesis of menaquinone]
  • Gene

    Coordinates
    2,381,919 2,382,965

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • (2E,6E)-farnesyl diphosphate + 4 isopentenyl diphosphate --> all-trans-heptaprenyl diphosphate + 4 diphosphate (according to UniProt)
  • Protein family

  • FPP/GGPP synthase family (with [protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|YqiD], according to UniProt)
  • Paralogous protein(s)

  • [protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|YqiD]
  • Structure

  • [PDB|5H9D] (from Staphylococcus aureus, 47% identity) [pubmed|27457559]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]-[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]-[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]-[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE22740 ([gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • BKK22740 ([gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • References

  • 12682299,9720033,28189581,27457559