SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


heptaprenyl diphosphate synthase component II
39.36 kDa
protein length
348 aa Sequence Blast
gene length
1047 bp Sequence Blast
menaquinone biosynthesis
heptaprenyl diphosphate synthase component II (together with [protein|C45A5935559F0DAAD70F808725AF730BC18A2B0A|HepS])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of menaquinone]
  • Gene

    2,381,919 2,382,965

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • (2E,6E)-farnesyl diphosphate + 4 isopentenyl diphosphate --> all-trans-heptaprenyl diphosphate + 4 diphosphate (according to UniProt)
  • Protein family

  • FPP/GGPP synthase family (with [protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|YqiD], according to UniProt)
  • Paralogous protein(s)

  • [protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|YqiD]
  • Structure

  • [PDB|5H9D] (from Staphylococcus aureus, 47% identity) [pubmed|27457559]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE22740 ([gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • BKK22740 ([gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • References

  • 12682299,9720033,28189581,27457559