SubtiBank SubtiBank
hepT
The papers of the month are back! Check them out! Link here

hepT

heptaprenyl diphosphate synthase component II
locus
BSU22740
pI
6.28
mw
39.36 kDa
protein length
348 aa Sequence Blast
gene length
1044 bp Sequence Blast
function
menaquinone biosynthesis
product
heptaprenyl diphosphate synthase component II (together with HepS)
essential
no
ec
2.5.1.30
synonyms
gerCC, hepB, gerC58

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.8|Biosynthesis of menaquinone]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    2,381,919 → 2,382,965

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • All-trans-hexaprenyl diphosphate + isopentenyl diphosphate = diphosphate + all-trans-heptaprenyl diphosphate (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|YqiD]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • BKE22740 (Δ[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • BKK22740 (Δ[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
  • References

  • 12682299,9720033,28189581