SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


type IV apurinic/apyrimidinic endonuclease
32.92 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
repair of oxidative DNA damage in spores
type IV apurinic/apyrimidinic endonuclease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|A/P endonucleases]
  • Gene

    2,593,281 2,594,174

    Phenotypes of a mutant

  • an ''[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] [gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]'' double mutant is impaired in germination and spore outgrowth due to the accumulation of DNA lesions, this can be rescued by inactivation of ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]'' [Pubmed|24244006]
  • an ''[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] [gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]'' double mutant is sensitive to radiation [Pubmed|24123749]
  • sensitive to blue light-induced DNA damage [pubmed|30054368]
  • reduced resistance towards electron beams [pubmed|31948638]
  • The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage to 5'-phosphooligonucleotide end-products (according to UniProt)
  • Protein family

  • AP endonuclease 2 family (single member, according to UniProt)
  • Structure

  • [PDB|3AAL] (from Geobacillus kaustophilus, 80% identity) [pubmed|21358045]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C462 (yqfS::erm), available at the [ NBRP B. subtilis, Japan]
  • available in [SW|Mario Pedraza-Reyes]'s lab
  • GP899 (Δ''nfo''::''kan'') and GP1502 (''nfo''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|22178973]
  • BKE25130 (Δ[gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTATTCTCAGCAACAGGT, downstream forward: _UP4_TAAAAAATGGGGGATAACAC
  • BKK25130 (Δ[gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCTATTCTCAGCAACAGGT, downstream forward: _UP4_TAAAAAATGGGGGATAACAC
  • References


  • 22933559
  • Original publications

  • 24244006,18203828,16237020,12949090,19930460,12486072,21441501,24123749,24123749,24914186,21358045,30054368,31948638