SubtiBank SubtiBank
yhaJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhaJ

putative bacteriocin
locus
BSU_09965
pI
9.44
mw
20.00 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
unknown
product
putative bacteriocin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.16|Biosynthesis of antibacterial compounds/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,072,042 1,072,560

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE09965 ([gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09965 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGTCATCCTTCCAT, downstream forward: _UP4_TAGTCAAACCCTGGTGCTGG
  • BKK09965 ([gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09965 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGTCATCCTTCCAT, downstream forward: _UP4_TAGTCAAACCCTGGTGCTGG
  • References

  • 16845009