SubtiBank SubtiBank
yhaJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhaJ

putative bacteriocin
locus
BSU09965
pI
9.44
mw
20.00 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
unknown
product
putative bacteriocin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.16|Biosynthesis of antibacterial compounds/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,072,042 1,072,560

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE09965 ([gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09965 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGTCATCCTTCCAT, downstream forward: _UP4_TAGTCAAACCCTGGTGCTGG
  • BKK09965 ([gene|3C7A7CA1EE4A785436FA49C90546E3F3B3ABF0A6|yhaJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09965 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAGTCATCCTTCCAT, downstream forward: _UP4_TAGTCAAACCCTGGTGCTGG
  • References

  • 16845009