SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


adenylyl-sulfate kinase
22.40 kDa
protein length
197 aa Sequence Blast
gene length
594 bp Sequence Blast
sulfate reduction and activation
adenylyl-sulfate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • Gene

    1,633,369 1,633,962

    The protein

    Catalyzed reaction/ biological activity

  • adenosine 5'-phosphosulfate + ATP --> 3'-phosphoadenylyl sulfate + ADP + H+ (according to UniProt)
  • Protein family

  • APS kinase family (with [protein|FE2B31E5EBE6C4BA4FC4AAC485A00C97315E6AAB|YisZ], according to UniProt)
  • Structure

  • [PDB|3CR8] (from ''Thiobacillus denitrificans'', 46% identity, 62% similarity) [Pubmed|19770499]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B367 (ylnC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15600 ([gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGATTTGTCACTGCCAGTC, downstream forward: _UP4_TGAATATGATCTGCTGCGTT
  • BKK15600 ([gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGATTTGTCACTGCCAGTC, downstream forward: _UP4_TGAATATGATCTGCTGCGTT
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 16267287,11004190,12107147,18039762