SubtiBank SubtiBank
cysC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cysC

adenylyl-sulfate kinase
locus
BSU15600
pI
5.08
mw
22.40 kDa
protein length
197 aa Sequence Blast
gene length
594 bp Sequence Blast
function
sulfate reduction and activation
product
adenylyl-sulfate kinase
essential
no
ec
2.7.1.25
synonyms
ylnC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • Gene

    Coordinates
    1,633,369 1,633,962

    The protein

    Catalyzed reaction/ biological activity

  • ATP + adenylyl sulfate = ADP + 3'-phosphoadenylyl sulfate (according to Swiss-Prot)
  • Protein family

  • APS kinase family (according to Swiss-Prot)
  • Structure

  • [PDB|3CR8] (from ''Thiobacillus denitrificans'', 46% identity, 62% similarity) [Pubmed|19770499]
  • Expression and Regulation

    Operons

    genes
    [gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
    description
    [Pubmed|11004190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B367 (ylnC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1366 NBRP B. subtilis, Japan]
  • BKE15600 ([gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGATTTGTCACTGCCAGTC, downstream forward: _UP4_TGAATATGATCTGCTGCGTT
  • BKK15600 ([gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGATTTGTCACTGCCAGTC, downstream forward: _UP4_TGAATATGATCTGCTGCGTT
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 16267287,11004190,12107147,18039762