SubtiBank SubtiBank
yczG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yczG

similar to transcriptional regulator ([SW|ArsR family])
locus
BSU_03880
pI
7.17
mw
11.70 kDa
protein length
104 aa Sequence Blast
gene length
315 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    439,709 440,023

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 6-100) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3C4948387A642B6F9F36893C0CA75888A8353C50|yczG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE03880 ([gene|3C4948387A642B6F9F36893C0CA75888A8353C50|yczG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACACAAATGTATCATA, downstream forward: _UP4_AATGTAGACCAGGACCGCTG
  • BKK03880 ([gene|3C4948387A642B6F9F36893C0CA75888A8353C50|yczG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACACAAATGTATCATA, downstream forward: _UP4_AATGTAGACCAGGACCGCTG
  • References

  • 23504016