SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


surfactin synthetase / competence
400.86 kDa
protein length
3583 aa Sequence Blast
gene length
10752 bp Sequence Blast
antibiotic synthesis
surfactin synthetase / competence

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    387,744 398,495

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • partial match (more than 1,000 amino acids): [protein|95B75CFF126AF0AD845E62B4036DD3B6DAC8C7FA|DhbF], [protein|13EB6B903088C11D985DDB7CEC864797058FE038|PksJ], [protein|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|PksN], [protein|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|PpsA], [protein|E7A2F93B33B1899313893D362D92405232BC9097|PpsB], [protein|C1C051209943E02369356075EAA733297E9478CB|PpsE], [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC]
  • Modification

  • phosphorylation on Ser-999 AND Ser-2045 [Pubmed|17218307]
  • phosphorylated on Arg-1378 [Pubmed|22517742]
  • Structure

  • [PDB|2VSQ] (termination module of [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|SrfAC], 39% identity) [pubmed|18583577]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1715856], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|25666134], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8830686], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|1715856,16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: activation, [Pubmed|16166527], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: repression, [Pubmed|12642660], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, [Pubmed|20817675], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|hxlR]' and '[protein|search|srfAA]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE03490 ([gene|3C484FDB3A440269E87D6B6E8500A875AC456666|srfAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTTGCTCATATGCCACC, downstream forward: _UP4_AACGAAAGCAAGGAGGAGCA
  • BKK03490 ([gene|3C484FDB3A440269E87D6B6E8500A875AC456666|srfAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTTGCTCATATGCCACC, downstream forward: _UP4_AACGAAAGCAAGGAGGAGCA
  • References


  • 20735481
  • Original publications

  • 17227471,16166527,8288534,10960106,12642660,8830686,18763711,17218307,17190806,1715856,16091051,22517742,8355610,22511326,20817675,18583577