SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


manganese [SW|ABC transporter] (binding protein, lipoprotein)
33.26 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
manganese uptake
manganese [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,145,038 3,145,958

    Phenotypes of a mutant

  • essential according to [ Kobayashi et al.], but a mutant has been constructed and studied by [ Que and Helmann, 2000]
  • The protein

    Protein family

  • bacterial solute-binding protein 9 family (with [protein|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|ZnuA], according to UniProt)
  • Paralogous protein(s)

  • [protein|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|ZnuA]
  • Structure

  • [PDB|1TOA] (zinc-binding protein from Treponema pallidum, 46% identity) [pubmed|10404217]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot), extracellular lipoprotein (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: repression, [Pubmed|12950915], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • regulation

  • repressed at high Mn(II) concentrations ([protein|search|MntR]) [Pubmed|12950915]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mntA]' and '[protein|search|menC]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-A285 (ytgA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30770 ([gene|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|mntA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCTCCTCCTCTTTG, downstream forward: _UP4_TAAAGAAAAGAGGTGGAGGA
  • BKK30770 ([gene|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|mntA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTCTCCTCCTCTTTG, downstream forward: _UP4_TAAAGAAAAGAGGTGGAGGA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 10760146,10092453,12950915,10760146,18957862,10760146,17114254,20525796,10404217