SubtiBank SubtiBank
ygaF [2019-09-04 10:36:25]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ygaF [2019-09-04 10:36:25]

similar to thioredoxin-dependent hydroperoxide peroxidase
17.97 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
resistance against oxidative stress

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.9|Resistance against oxidative and electrophile stress/ based on similarity]
  • Gene

    943,891 944,364

    The protein

    Catalyzed reaction/ biological activity

  • [protein]-dithiol + hydroperoxide --> [protein]-disulfide + alcohol + H2O (according to UniProt)
  • Protein family

  • [SW|peroxiredoxin family] (according to UniProt)
  • Structure

  • [PDB|5ENU] (from Burkholderia ambifaria, 48% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE08720 ([gene|3C139835154FA236066CF2FB82A3C32E3A72D65E|ygaF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTTACCTCCGGATG, downstream forward: _UP4_TAAATCTCTATGAGCCTATG
  • BKK08720 ([gene|3C139835154FA236066CF2FB82A3C32E3A72D65E|ygaF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTTACCTCCGGATG, downstream forward: _UP4_TAAATCTCTATGAGCCTATG
  • References

  • 10644761