SubtiBank SubtiBank
ygaF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ygaF

similar to thioredoxin-dependent hydroperoxide peroxidase
locus
BSU_08720
pI
5.86
mw
17.97 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
resistance against oxidative stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.9|Resistance against oxidative and electrophile stress/ based on similarity]
  • Gene

    Coordinates
    943,891 944,364

    The protein

    Catalyzed reaction/ biological activity

  • [protein]-dithiol + hydroperoxide --> [protein]-disulfide + alcohol + H2O (according to UniProt)
  • Protein family

  • [SW|peroxiredoxin family] (according to UniProt)
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 3-156) (according to UniProt)
  • Structure

  • [PDB|5ENU] (from Burkholderia ambifaria, 48% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|3C139835154FA236066CF2FB82A3C32E3A72D65E|ygaF]-[gene|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE08720 ([gene|3C139835154FA236066CF2FB82A3C32E3A72D65E|ygaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTTACCTCCGGATG, downstream forward: _UP4_TAAATCTCTATGAGCCTATG
  • BKK08720 ([gene|3C139835154FA236066CF2FB82A3C32E3A72D65E|ygaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTTACCTCCGGATG, downstream forward: _UP4_TAAATCTCTATGAGCCTATG
  • Expression vector

  • pGP2338: expression of ''ygaF'' via [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • References

  • 10644761