SubtiBank SubtiBank
yqfX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqfX

unknown
locus
BSU_25080
pI
4.53
mw
13.76 kDa
protein length
129 aa Sequence Blast
gene length
390 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,590,282 2,590,671

    Expression and Regulation

    Operons

    genes
    [gene|3BFD8FAAC51E7B128A5C860D77C6D4E131E5D7ED|yqfX]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE25080 ([gene|3BFD8FAAC51E7B128A5C860D77C6D4E131E5D7ED|yqfX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCCCTTCTGTTTTA, downstream forward: _UP4_TAACACAAAAAAGCTTGACG
  • BKK25080 ([gene|3BFD8FAAC51E7B128A5C860D77C6D4E131E5D7ED|yqfX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCCCTTCTGTTTTA, downstream forward: _UP4_TAACACAAAAAAGCTTGACG
  • References

    Research papers

  • 30782632