SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to 3-oxoacyl- acyl-carrier protein reductase
27.82 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,010,661 3,011,428

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG]:
  • Structure

  • [PDB|3I4F] (from Bacillus Thuringiensis 69% identity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-A158 (ytkK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29420 ([gene|3BF3EC6B3139744D968B2FF18CBEEEF15B591AFF|ytkK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGAATACCTCCCAAAG, downstream forward: _UP4_TAAGTTTTTCAGCTTTTTAA
  • BKK29420 ([gene|3BF3EC6B3139744D968B2FF18CBEEEF15B591AFF|ytkK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGAATACCTCCCAAAG, downstream forward: _UP4_TAAGTTTTTCAGCTTTTTAA