SubtiBank SubtiBank
efeU
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

efeU

elemental iron uptake system (permease), high affinity uptake of ferric iron (Fe(III))
locus
BSU_38280
pI
8.96
mw
52.24 kDa
protein length
481 aa Sequence Blast
gene length
1446 bp Sequence Blast
function
elemental iron uptake
product
elemental iron uptake system (permease)
essential
no
synonyms
ywbL

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.2|Elemental iron transport system]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.5|Elemental iron transport system]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,929,105 3,930,550

    The protein

    Protein family

  • Oxidase-dependent Fe transporter (OFeT) (TC 9.A.10.1) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3BED98E311EF380AE77327C7F0A83254805089C0|efeU]-[gene|B31884DC49684A276D65E21A5F59AFDADEB9749C|efeO]-[gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23764491], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B226 (ywbL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1225 NBRP B. subtilis, Japan]
  • BKE38280 ([gene|3BED98E311EF380AE77327C7F0A83254805089C0|efeU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTCCTCCTATAAT, downstream forward: _UP4_ACAAACGGAAAGGAACTGAC
  • BKK38280 ([gene|3BED98E311EF380AE77327C7F0A83254805089C0|efeU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTCCTCCTATAAT, downstream forward: _UP4_ACAAACGGAAAGGAACTGAC
  • References

  • 16672620,23180473,12354229,23764491,27795321,29133393