SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


35.16 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    562,502 563,461

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2[SW|EamA domain]s (aa 18-149, aa 171-296) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials


  • MGNA-C080 (ydeD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05160 ([gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|ydeD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATGACTCCTCACTAA, downstream forward: _UP4_TAGGGGCTTTTTTTGCTTAC
  • BKK05160 ([gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|ydeD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATGACTCCTCACTAA, downstream forward: _UP4_TAGGGGCTTTTTTTGCTTAC