SubtiBank SubtiBank
ydeD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeD

unknown
locus
BSU_05160
pI
9.62
mw
35.16 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    562,502 563,461

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2[SW|EamA domain]s (aa 18-149, aa 171-296) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-C080 (ydeD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2078 NBRP B. subtilis, Japan]
  • BKE05160 ([gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|ydeD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATGACTCCTCACTAA, downstream forward: _UP4_TAGGGGCTTTTTTTGCTTAC
  • BKK05160 ([gene|3BD05DE3ED5B293980F47EB621C54C7339F78DC7|ydeD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATGACTCCTCACTAA, downstream forward: _UP4_TAGGGGCTTTTTTTGCTTAC