SubtiBank SubtiBank
yosA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yosA

unknown
locus
BSU_20190
pI
5.49
mw
3.96 kDa
protein length
gene length
120 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,169,807 2,169,926

    The protein

    Protein family

  • [SW|SscA family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3BCF31DB9B5FB997DFFA20B02A49B4475D115814|yosA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE20190 ([gene|3BCF31DB9B5FB997DFFA20B02A49B4475D115814|yosA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCCACCTCCTTTAG, downstream forward: _UP4_TAATCTCAGAGTAAATCCAG
  • BKK20190 ([gene|3BCF31DB9B5FB997DFFA20B02A49B4475D115814|yosA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGCCACCTCCTTTAG, downstream forward: _UP4_TAATCTCAGAGTAAATCCAG