SubtiBank SubtiBank
phoB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phoB

alkaline phosphatase III, heptaprenylglyceryl phosphate processing phosphatase
locus
BSU_05740
pI
5.89
mw
50.36 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
function
aquisition of phosphate upon phosphate starvation, ether lipid synthesis
product
alkaline phosphatase III, heptaprenylglyceryl phosphate processing phosphatase
essential
no
ec
3.1.3.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    620,097 621,485

    The protein

    Catalyzed reaction/ biological activity

  • phosphate monoester + H2O --> alcohol + phosphate (according to UniProt)
  • Protein family

  • alkaline phosphatase family (with [protein|E0430C16C41440633647976A0F9183E24268E198|PhoA], according to UniProt)
  • Paralogous protein(s)

  • [protein|E0430C16C41440633647976A0F9183E24268E198|PhoA]
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|3A52] (from ''Shewanella sp.'', 41% identity) [Pubmed|20057143]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|3B95AB3021280215B6B487A348D78FB5797AEEA6|phoB]-[gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]
    description
    [Pubmed|10913081]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,16030210], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9335276,10913081,16030210], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|9335276,10913081,16030210]
  • view in new tab

    Biological materials

    Mutant

  • 1A767 ( ''phoB''::''cat''), [Pubmed|9426145], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A767&Search=1A767 BGSC]
  • BKE05740 ([gene|3B95AB3021280215B6B487A348D78FB5797AEEA6|phoB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGGATAACCTCCTAAA, downstream forward: _UP4_TAAAAGAATACAAGGTGTCC
  • BKK05740 ([gene|3B95AB3021280215B6B487A348D78FB5797AEEA6|phoB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGGATAACCTCCTAAA, downstream forward: _UP4_TAAAAGAATACAAGGTGTCC
  • References

  • 16030210,9335276,8088554,10913081,16491025,8113174,9335276,18957862,16493705,25666134,20057143,27118079,27226549