SubtiBank SubtiBank
pspA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pspA

phage shock protein A homolog
locus
BSU_06180
pI
5.78
mw
24.99 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ydjF

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    671,245 671,928

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • PspA/IM30 family (with [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH], according to UniProt)
  • Paralogous protein(s)

  • [protein|AE4BF12C368468C553EED7A696D5EFC63F56CA39|LiaH]
  • Structure

  • [PDB|4WHE] (from E. coli, 34% identity, corresponds to aa 1 ... 133) [pubmed|26235546]
  • [SW|Localization]

  • cytoplasma (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]-[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]-[gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]-[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]
    description
    [Pubmed|11454200]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11454200], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by alkaline shock ([protein|search|SigW]) [Pubmed|11454200]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C430 (yqgI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2428 NBRP B. subtilis, Japan]
  • BKE06180 ([gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGTTCCTCCTAA, downstream forward: _UP4_TAATACATAGGAGGCCGCAG
  • BKK06180 ([gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCGTTCCTCCTAA, downstream forward: _UP4_TAATACATAGGAGGCCGCAG
  • References

  • 11454200,18840696,22926563,23980836,27791134,26235546