SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


2-oxoglutarate dehydrogenase (E1 subunit)
105.54 kDa
protein length
944 aa Sequence Blast
gene length
2835 bp Sequence Blast
TCA cycle
2-oxoglutarate dehydrogenase (E1 subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,108,774 2,111,608

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + [dihydrolipoyllysine-residue succinyltransferase]-(R)-N6-lipoyl-L-lysine + H+ --> [dihydrolipoyllysine-residue succinyltransferase]-(R)-N6-(S8-succinyldihydrolipoyl)-L-lysine + CO2 (according to UniProt)
  • Protein family

  • alpha-ketoglutarate dehydrogenase family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-66 and Arg-621 [Pubmed|22517742]
  • Structure

  • [PDB|2JGD] (from ''Escherichia coli'', 38% identity, 55% similarity) [Pubmed|17367808]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Additional information

  • extensive information on the structure and enzymatic properties of 2-oxoglutarate dehydrogenase can be found at [ Proteopedia]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1508153], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (2.4-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • GP671 (spc), GP684 (cat), available in [SW|Jörg Stülke]'s lab
  • GP1274 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA])::''cat'', available in [SW|Jörg Stülke]'s lab
  • GP1276 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''cat'', available in [SW|Jörg Stülke]'s lab
  • GP2183 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA])::''ermC'', available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
  • GP2332 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2334 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE19370 ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATATTACCCCCAA, downstream forward: _UP4_AAAAACTAAGGGGGAAATGA
  • BKK19370 ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATATTACCCCCAA, downstream forward: _UP4_AAAAACTAAGGGGGAAATGA
  • lacZ fusion

  • pGP3106 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 10672230
  • Original publications

  • 2500417,20933603,1508153,11976317,12850135,22517742,22900538,24263382