pbpA

class B penicillin-binding protein PBP 2A, required for [SW|cell wall synthesis] during cell elongation, part of the [protein|search|Rod complex] for lateral [SW|cell wall synthesis] and control of cell diameter

locus: BSU_25000

pI: 9.57

mw: 79.96 kDa

protein length: 716 aa

gene length: 2151 bp

function: formation of a rod-shaped peptidoglycan cell wall, spore outgrowth

product: penicillin-binding protein PBP 2A

essential: no

synonyms: yqgF

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.7|Penicillin-binding proteins]
• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
• [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 2,581,771 2,583,921

The protein

Catalyzed reaction/ biological activity

• required for [SW|cell wall synthesis] during cell elongation [Pubmed|12896990]
• driver of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] dynamics [Pubmed|21636744,21636745]

Protein family

• [SW|transpeptidase family] (according to UniProt)

Paralogous protein(s)

• [protein|883DFF72888D280A102E53CC1D69A8B1C7BE2907|PbpH]

Structure

• [PDB|3VSK] (from Staphylococcus aureus, 45% identity) [pubmed|22846910]

[SW|Localization]

• extracellular (signal peptide) [Pubmed|18957862]
• during vegetative growth: evenly distributed along the membrane [pubmed|14731276]
• localization depends on the availability of peptidoglyan precursors (lipid II) [Pubmed|23895585]

Expression and Regulation

Operons

• genes: [gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]
  description: [Pubmed|21815947]

  additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]

Biological materials

Mutant

• MGNA-C461 (yqgF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2459 NBRP B. subtilis, Japan]
• BKE25000 ([gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCACCTTTTCTAT, downstream forward: _UP4_TAAAAAAAAACGCTCACATG
• BKK25000 ([gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACATCACCTTTTCTAT, downstream forward: _UP4_TAAAAAAAAACGCTCACATG

GFP fusion

• 3103 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]::pSG5043 (cat P_xyl-gfpa-[gene|3B4F035535D6504405567E7C44E72902A11F7447|pbpA]1-804) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [http://bgsc.org BGSC]

two-hybrid system

• ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jeff Errington] lab

labs

• [SW|Jeff Errington], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/jeff.errington homepage]

References

• 9851991,9139922,12896990,18957862,20487272,21636744,21636745,21815947,23895585,22846910,14731276,31086310,32152588