SubtiBank SubtiBank
yojM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yojM

superoxide dismutase
locus
BSU_19400
pI
5.64
mw
20.81 kDa
protein length
196 aa Sequence Blast
gene length
591 bp Sequence Blast
function
unknown
product
superoxide dismutase
essential
no
synonyms
sodC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,114,742 2,115,332

    The protein

    Protein family

  • Cu-Zn superoxide dismutase family (single member, according to UniProt)
  • [SW|Cofactors]

  • zinc
  • Structure

  • [PDB|1XTL] [Pubmed|15897454]
  • Expression and Regulation

    Operons

    genes
    [gene|0FBE3F7ECACA7FCFAA4EE32E9B2BB35F0B793C0F|cwlS]-[gene|3B45734D18D01BAB6D244DE3547C84F9488075FB|yojM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B423 (yojM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1422 NBRP B. subtilis, Japan]
  • BKE19400 ([gene|3B45734D18D01BAB6D244DE3547C84F9488075FB|yojM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTCTCCCCCTTGTT, downstream forward: _UP4_TAATATCATCCAGGCCCTTT
  • BKK19400 ([gene|3B45734D18D01BAB6D244DE3547C84F9488075FB|yojM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTCTCCCCCTTGTT, downstream forward: _UP4_TAATATCATCCAGGCCCTTT
  • References

  • 15897454