SubtiBank SubtiBank
yojM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yojM

superoxide dismutase
locus
BSU19400
pI
5.64
mw
20.81 kDa
protein length
196 aa Sequence Blast
gene length
591 bp Sequence Blast
function
unknown
product
superoxide dismutase
essential
no
synonyms
sodC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,114,742 2,115,332

    The protein

    Protein family

  • Cu-Zn superoxide dismutase family(according to UniProt)
  • [SW|Cofactors]

  • zinc
  • Structure

  • [PDB|1XTL] [Pubmed|15897454]
  • Expression and Regulation

    Operons

    genes
    [gene|0FBE3F7ECACA7FCFAA4EE32E9B2BB35F0B793C0F|cwlS]-[gene|3B45734D18D01BAB6D244DE3547C84F9488075FB|yojM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B423 (yojM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1422 NBRP B. subtilis, Japan]
  • BKE19400 ([gene|3B45734D18D01BAB6D244DE3547C84F9488075FB|yojM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTCTCCCCCTTGTT, downstream forward: _UP4_TAATATCATCCAGGCCCTTT
  • BKK19400 ([gene|3B45734D18D01BAB6D244DE3547C84F9488075FB|yojM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGTCTCCCCCTTGTT, downstream forward: _UP4_TAATATCATCCAGGCCCTTT
  • References

  • 15897454