SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to [SW|ABC transporter] (membrane protein)
44.89 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
[SW|ABC transporter] (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Exporters of unknown function]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,070,246 3,071,403

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • expressed under conditions of cell wall stress ([protein|search|SigW]) [Pubmed|11866510,12207695]
  • view in new tab

    Biological materials


  • MGNA-A818 (ythQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30000 ([gene|3ACDFBD5615510FA015486C7A3C7023226EC3476|ythQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGAAAAAAGAGCGTACGCC, downstream forward: _UP4_TAAAAAACCCAAACGGCGAC
  • BKK30000 ([gene|3ACDFBD5615510FA015486C7A3C7023226EC3476|ythQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCGAAAAAAGAGCGTACGCC, downstream forward: _UP4_TAAAAAACCCAAACGGCGAC
  • References

  • 10092453,11866510,12207695