SubtiBank SubtiBank
yveA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yveA

similar to aspartate/ glutamate transporter
locus
BSU_34470
pI
9.68
mw
56.82 kDa
protein length
520 aa Sequence Blast
gene length
1563 bp Sequence Blast
function
unknown
product
similar to aspartate/ glutamate transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.5|Biosynthesis/ acquisition of aspartate/ asparagine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.6|Utilization of asparagine/ aspartate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,539,165 3,540,727

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|AimA]
  • Structure

  • [PDB|5OQT] (YneM from E. coli, 28% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Additional information

  • the protein has been annotated as aspartate transporter. It is, however, not implicated in aspartate uptake in exponentially growing cells [Pubmed|25344233]
  • Expression and Regulation

    Operons

    genes
    [gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|2428811], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • GP2385 ∆''[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • GP2795 ∆''[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]''::''spec'', available in [SW|Jörg Stülke]'s lab
  • GP2822 ∆''[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]''::''neo'', available in [SW|Jörg Stülke]'s lab
  • BKE34470 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA, downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
  • BKK34470 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA, downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
  • MDB43 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::neo trpC2 pheA1 available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s labs [Pubmed|25344233]
  • MGNA-B615 (yveA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1614 NBRP B. subtilis, Japan]
  • References

  • 12730183,11739774,2428811,3039303,16497325,25344233,29416041