SubtiBank SubtiBank
yveA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yveA

similar to aspartate/ glutamate transporter
locus
BSU_34470
pI
9.68
mw
56.82 kDa
protein length
520 aa Sequence Blast
gene length
1563 bp Sequence Blast
function
unknown
product
similar to aspartate/ glutamate transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.5|Biosynthesis/ acquisition of aspartate/ asparagine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.6|Utilization of asparagine/ aspartate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,539,165 3,540,727

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|YbeC]
  • Structure

  • [PDB|5OQT] (YneM from E. coli, 28% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Additional information

  • the protein has been annotated as aspartate transporter. It is, however, not implicated in aspartate uptake in exponentially growing cells [Pubmed|25344233]
  • Expression and Regulation

    Operons

    genes
    [gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|2428811], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • GP2385 ∆''[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • GP2795 ∆''[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]''::''spec'', available in [SW|Jörg Stülke]'s lab
  • GP2822 ∆''[gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]''::''neo'', available in [SW|Jörg Stülke]'s lab
  • BKE34470 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA, downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
  • BKK34470 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGCTTCCTCCTTTGAA, downstream forward: _UP4_TAAAGAAGCAAGAGGTTTTC
  • MDB43 ([gene|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|yveA]::neo trpC2 pheA1 available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s labs [Pubmed|25344233]
  • MGNA-B615 (yveA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1614 NBRP B. subtilis, Japan]
  • References

  • 12730183,11739774,2428811,3039303,16497325,25344233,29416041