SubtiBank SubtiBank
glgP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glgP

glycogen phosphorylase
locus
BSU30940
pI
6.28
mw
91.56 kDa
protein length
798 aa Sequence Blast
gene length
2394 bp Sequence Blast
function
glycogen biosynthesis
product
glycogen phosphorylase
essential
no
ec
2.4.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.5|Biosynthesis of glycogen]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,163,735 → 3,166,131

    The protein

    Catalyzed reaction/ biological activity

  • (1,4-alpha-D-glucosyl)(n) + phosphate = (1,4-alpha-D-glucosyl)(n-1) + alpha-D-glucose 1-phosphate (according to Swiss-Prot)
  • Protein family

  • glycogen phosphorylase family (according to Swiss-Prot)
  • Modification

  • phosphorylation on (Thr-291 OR Ser-294) [Pubmed|17218307]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|1PYG] (from Oryctolagus cuniculus, 45% identity) [pubmed|1962195]
  • Expression and Regulation

    Operons

    genes
    [gene|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|glgB]-[gene|B665735B76462724A3C7A1E89D3E613C18F21399|glgC]-[gene|63A4FD35A2E72C665BFA3F2632F06C7A0C954087|glgD]-[gene|EBEA85AD543B79C321CB5F28D1B7E1248640DC1D|glgA]-[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]
    description
    [Pubmed|8145641]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8145641], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|8145641]
  • view in new tab

    Biological materials

    Mutant

  • BKE30940 (Δ[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAAAATAAGTCTGCAAAGC, downstream forward: _UP4_TGAAAAAGCCGCTGTATAAG
  • BKK30940 (Δ[gene|3AB4513126EFF54996A54CB7DEB6062C1A06AAC3|glgP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAAAAATAAGTCTGCAAAGC, downstream forward: _UP4_TGAAAAAGCCGCTGTATAAG
  • References

  • 17218307,8145641,1962195