SubtiBank SubtiBank
yceH [2020-10-28 09:10:29]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yceH [2020-10-28 09:10:29]

similar to toxic anion resistance protein
41.51 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    316,512 317,603

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • TelA family (with [protein|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|YaaN], according to UniProt)
  • Paralogous protein(s)

  • [protein|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|YaaN]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|19047346], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE02940 ([gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGCTTTTCTTCT, downstream forward: _UP4_TAATAAAAACCCCGCTTGTG
  • BKK02940 ([gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGCTTTTCTTCT, downstream forward: _UP4_TAATAAAAACCCCGCTTGTG
  • GP644 (''[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]''::''kan'' trpC2), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 11544224,11866510,18179421,23980836