SubtiBank SubtiBank
yceH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yceH

similar to toxic anion resistance protein
locus
BSU_02940
pI
5.75
mw
41.51 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    316,512 317,603

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • TelA family (with [protein|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|YaaN], according to UniProt)
  • Paralogous protein(s)

  • [protein|5231A0EE9C5A7556817B686D5B2B7B72B675BCAC|YaaN]
  • Expression and Regulation

    Operons

    genes
    [gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]-[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]-[gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]-[gene|F16A11027D8D320D3D64E44038E29921A946955B|yceF]-[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]-[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|19047346], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE02940 ([gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGCTTTTCTTCT, downstream forward: _UP4_TAATAAAAACCCCGCTTGTG
  • BKK02940 ([gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGCTTTTCTTCT, downstream forward: _UP4_TAATAAAAACCCCGCTTGTG
  • GP644 (''[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]''::''kan'' trpC2), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 11544224,11866510,18179421,23980836