SubtiBank SubtiBank
spoIIT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIIT

co-activator (with [protein|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|SpoIIR]) for triggering [protein|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|SpoIIGA]-dependent processing of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]
locus
BSU_36770
pI
6.88
mw
28.48 kDa
protein length
246 aa Sequence Blast
gene length
741 bp Sequence Blast
function
control of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE] processing and activation
product
co-activator (with [protein|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|SpoIIR]) for triggering [protein|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|SpoIIGA]-dependent processing of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]
essential
no
synonyms
ywmB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    Coordinates
    3,779,293 3,780,033

    Phenotypes of a mutant

  • mild sporulation defect due to inefficient activation of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE] [Pubmed|26735940]
  • inactivation of ''[gene|3A8E0417C4EC85FDDE1178B775F6579C8F1009C6|spoIIT]'' reduces sporulation efficiency to 38% that of wild type cells; abortively disporic [Pubmed|26735940]
  • The protein

    Structure

  • [PDB|2FPN]
  • [SW|Localization]

  • secreted from the forespore to the intermembrane space between the forespore and the mother cell [Pubmed|26735940]
  • Expression and Regulation

    Operons

    genes
    [gene|32CE4F77F08F926152BECAB56E2841E1FFB27600|ywzB]-[gene|3A8E0417C4EC85FDDE1178B775F6579C8F1009C6|spoIIT]-[gene|DA763F7C2192655C590752C2A285ADF902B11BCA|murAA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|26735940]
  • view in new tab

    genes
    [gene|3A8E0417C4EC85FDDE1178B775F6579C8F1009C6|spoIIT]-[gene|DA763F7C2192655C590752C2A285ADF902B11BCA|murAA]
    description
    [Pubmed|26735940]

    regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|26735940]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A189 (ywmB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/189 NBRP B. subtilis, Japan]
  • BKE36770 ([gene|3A8E0417C4EC85FDDE1178B775F6579C8F1009C6|spoIIT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATCTCTCCCCCTT, downstream forward: _UP4_TAATATAGAGAATTTAGGGA
  • BKK36770 ([gene|3A8E0417C4EC85FDDE1178B775F6579C8F1009C6|spoIIT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATCTCTCCCCCTT, downstream forward: _UP4_TAATATAGAGAATTTAGGGA
  • References

    Reviews

  • 31350897
  • Original Publications

  • 26735940,22383849,26735940