SubtiBank SubtiBank
yqaN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqaN

unknown, skin element
locus
BSU26250
pI
10.12
mw
15.98 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,692,933 2,693,361

    Expression and Regulation

    Operons

    genes
    [gene|A9AACF8F25A1A80B3AE2A94DFC3A0E09012B55E7|yqzO]-[gene|3A89444BA25E4940C4197AACBD8B66BC1C65A493|yqaN]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    genes
    [gene|16BEDCFFB1671793061ACE4AC528D3B8EB177DC8|yqaF]-[gene|02216407B5EDB98FAF611E22B2323C819B9D58BB|yqdA]-[gene|03DAF537379754763646AF3AF2AD811B107F5302|yqaG]-[gene|F6AB74740776179E77218DB831FEE03773B7353F|yqaH]-[gene|5EA0F507F949D249D5B5B860861BBEB4197E01C5|yqaI]-[gene|CFCCFD8C6420CC1DD076B091AD3D914FC8AB22D5|yqaJ]-[gene|903E11BD2CFF3EE1A831F0F50F91741893C3DAB8|yqaK]-[gene|AB4AF9BD3E16FD72370AFC82CDD1531518053E6F|yqaL]-[gene|F301EA8201BF27BAFAD4F95EC3A580A91B970B06|yqaM]-[gene|A9AACF8F25A1A80B3AE2A94DFC3A0E09012B55E7|yqzO]-[gene|3A89444BA25E4940C4197AACBD8B66BC1C65A493|yqaN]
    description
    [Pubmed|20889742]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20889742], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|846161AE54F170075F2B2133A8D56FE39A5AF8D9|SknR]: repression, [Pubmed|20889742], in [regulon|846161AE54F170075F2B2133A8D56FE39A5AF8D9|SknR regulon]
  • regulation

  • not expressed during normal growth ([protein|846161AE54F170075F2B2133A8D56FE39A5AF8D9|SknR]) [Pubmed|20889742]
  • additional information

  • A [protein|search|ncRNA] is predicted between [gene|CFCCFD8C6420CC1DD076B091AD3D914FC8AB22D5|yqaJ] and [gene|5EA0F507F949D249D5B5B860861BBEB4197E01C5|yqaI] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE26250 ([gene|3A89444BA25E4940C4197AACBD8B66BC1C65A493|yqaN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGTTCTTTACCTCCCG, downstream forward: _UP4_TAAAAATAAAAAACACCGAA
  • BKK26250 ([gene|3A89444BA25E4940C4197AACBD8B66BC1C65A493|yqaN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTGTTCTTTACCTCCCG, downstream forward: _UP4_TAAAAATAAAAAACACCGAA
  • References

  • 20889742,20525796