SubtiBank SubtiBank
nin

nin

inhibitor of the DNA degrading activity of [protein|99581CC6AFFA2D1392748B4D9C99DEF8B7601F75|NucA]
locus
BSU_03420
pI
4.92
mw
14.86 kDa
protein length
132 aa Sequence Blast
gene length
399 bp Sequence Blast
function
genetic transformation, DNA uptake
product
inhibitor of the DNA degrading activity of [protein|99581CC6AFFA2D1392748B4D9C99DEF8B7601F75|NucA]
essential
no
synonyms
comJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    371,729 372,127

    The protein

    Modification

  • phosphorylated on Arg-96 [Pubmed|22517742]
  • Structure

  • [PDB|4MQD]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|99581CC6AFFA2D1392748B4D9C99DEF8B7601F75|nucA]-[gene|3A54C644DD1CCA5C08CB9C5CD648D44889E68D23|nin]
    description
    [Pubmed|11359569]

    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|7746143], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE03420 ([gene|3A54C644DD1CCA5C08CB9C5CD648D44889E68D23|nin]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTGCTGTTCCTCCTCT, downstream forward: _UP4_TAATGAAAAACCCCTGAGAG
  • BKK03420 ([gene|3A54C644DD1CCA5C08CB9C5CD648D44889E68D23|nin]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTGCTGTTCCTCCTCT, downstream forward: _UP4_TAATGAAAAACCCCTGAGAG
  • References

  • 11814663,11359569,7746143,22517742