SubtiBank SubtiBank
yoeA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoeA

probable multidrug resistance protein
locus
BSU_18370
pI
10.00
mw
51.12 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
function
unknown
product
putative multidrug exporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.15|Multidrug exporters/ based on homology]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,000,960 2,002,351

    The protein

    Protein family

  • [SW|MOP exporter family]
  • [SW|multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family] (according to UniProt)
  • Structure

  • [PDB|3VVO] (MATE multidrug exporter from Pyrococcus furiosus, 25% identity) [pubmed|23535598]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3A45214C724902530D9808D41EDA20AFF71D1D59|yoeA]
    description
    [Pubmed|22383849]

    additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|yoeA]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE18370 ([gene|3A45214C724902530D9808D41EDA20AFF71D1D59|yoeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTAAAGGACTCCTTTA, downstream forward: _UP4_TAGCCTCCGAATCACACCGT
  • BKK18370 ([gene|3A45214C724902530D9808D41EDA20AFF71D1D59|yoeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTAAAGGACTCCTTTA, downstream forward: _UP4_TAGCCTCCGAATCACACCGT
  • References

  • 20525796,22383849,23535598