SubtiBank SubtiBank
ydhK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydhK

general stress protein, survival of ethanol and paraquat stresses
locus
BSU_05790
pI
7.41
mw
22.39 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
survival of stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    624,492 625,109

    The protein

    Structure

  • [PDB|4MDW]
  • [PDB|2KY9]
  • Expression and Regulation

    Operons

    genes
    [gene|3A0BC04A1A61ABA747838CAF5FD513D9ABE23201|ydhK]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528,10482513]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C186 (ydhK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2184 NBRP B. subtilis, Japan]
  • BKE05790 ([gene|3A0BC04A1A61ABA747838CAF5FD513D9ABE23201|ydhK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAAACATGCCCTCTC, downstream forward: _UP4_GCTAAATAATAAAAAATCCT
  • BKK05790 ([gene|3A0BC04A1A61ABA747838CAF5FD513D9ABE23201|ydhK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAAACATGCCCTCTC, downstream forward: _UP4_GCTAAATAATAAAAAATCCT
  • References

  • 15805528,10482513,22582280