SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


general stress protein, survival of ethanol and paraquat stresses
22.39 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
survival of stress conditions

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    624,492 625,109

    The protein


  • [PDB|4MDW]
  • [PDB|2KY9]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528,10482513]
  • view in new tab

    Biological materials


  • MGNA-C186 (ydhK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05790 ([gene|3A0BC04A1A61ABA747838CAF5FD513D9ABE23201|ydhK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAAACATGCCCTCTC, downstream forward: _UP4_GCTAAATAATAAAAAATCCT
  • BKK05790 ([gene|3A0BC04A1A61ABA747838CAF5FD513D9ABE23201|ydhK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGAAAACATGCCCTCTC, downstream forward: _UP4_GCTAAATAATAAAAAATCCT
  • References

  • 15805528,10482513,22582280