SubtiBank SubtiBank
uvrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

uvrA

excinuclease ABC (subunit A), required for transcription-dependent asymmetry in mutation rates of genes in the two orientations
locus
BSU_35160
pI
5.84
mw
105.83 kDa
protein length
957 aa Sequence Blast
gene length
2874 bp Sequence Blast
function
DNA repair after UV damage
product
excinuclease ABC (subunit A)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    3,610,064 3,612,937

    Phenotypes of a mutant

  • reduced stationary phase mutagenesis [Pubmed|27399782]
  • a [gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA] [gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB] mutant is sensitive to blue light-induced DNA damage [pubmed|30054368]
  • sensitive to Cr(VI) treatment [pubmed|30745368]
  • The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|ABC transporter domain]s (aa 309-587, aa 607-935) (according to UniProt)
  • Structure

  • [PDB|2R6F] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB]-[gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|8226626], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|8226626]
  • additional information

  • during [protein|search|sporulation] expressed both in the forespore and the mother cell [PubMed|24118570]
  • expression is induced in the presence of Cr(VI) [pubmed|30745368]
  • view in new tab

    Biological materials

    Mutant

  • BKE35160 ([gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCCGATCCATAGCCATTT, downstream forward: _UP4_TAAAACCCTCTGTTAAGAGG
  • BKK35160 ([gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCCGATCCATAGCCATTT, downstream forward: _UP4_TAAAACCCTCTGTTAAGAGG
  • References

    Reviews

  • 16464004,15927210,7801120,22933559
  • Original publications

  • 11751826,21145481,8226626,24118570,24118570,25713353,27399782,30054368,30745368