SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


excinuclease ABC (subunit A), required for transcription-dependent asymmetry in mutation rates of genes in the two orientations
105.83 kDa
protein length
957 aa Sequence Blast
gene length
2874 bp Sequence Blast
DNA repair after UV damage
excinuclease ABC (subunit A)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    3,610,064 3,612,937

    Phenotypes of a mutant

  • reduced stationary phase mutagenesis [Pubmed|27399782]
  • a [gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA] [gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB] mutant is sensitive to blue light-induced DNA damage [pubmed|30054368]
  • sensitive to Cr(VI) treatment [pubmed|30745368]
  • reduced resistance towards electron beams [pubmed|31948638]
  • The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|ABC transporter domain]s (aa 309-587, aa 607-935) (according to UniProt)
  • Structure

  • [PDB|2R6F] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|8226626], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|8226626]
  • additional information

  • during [protein|search|sporulation] expressed both in the forespore and the mother cell [PubMed|24118570]
  • expression is induced in the presence of Cr(VI) [pubmed|30745368]
  • view in new tab

    Biological materials


  • GP3534 (Δ([gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]-[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB])::kan), available in [SW|Jörg Stülke]'s lab
  • GP1175 (Δ([gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]-[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB])::ermC), available in [SW|Jörg Stülke]'s lab [pubmed|22178973]
  • BKE35160 ([gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCCGATCCATAGCCATTT, downstream forward: _UP4_TAAAACCCTCTGTTAAGAGG
  • BKK35160 ([gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCCGATCCATAGCCATTT, downstream forward: _UP4_TAAAACCCTCTGTTAAGAGG
  • References


  • 16464004,15927210,7801120,22933559
  • Original publications

  • 11751826,21145481,8226626,24118570,24118570,25713353,27399782,30054368,30745368,31948638