SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


thiol disulfide oxidoreductase, reduces [protein|B283B702D917E310130BC33A40BF6A5853C3D4C1|AhpA]
17.66 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
protection of proteins against oxidative damage
thiol disulfide oxidoreductase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    1,492,875 1,493,321

    The protein


  • [PDB|2B5X] (reduced form), [PDB|2B5Y] (oxidized form)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • GP1729 [gene|search|ahpAT]::kan trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-B344 (ykuV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14230 ([gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCCTCCTAT, downstream forward: _UP4_TAGGTATCTGACTAAATAGT
  • BKK14230 ([gene|398E6FAC317D9BD81FB80A7CC9DF1CC757F2FA98|ahpT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTTTTCCCTCCTAT, downstream forward: _UP4_TAGGTATCTGACTAAATAGT
  • References

  • 20817675,16418167,26787766