SubtiBank SubtiBank
yqxD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqxD

unknown
locus
BSU25230
pI
7.17
mw
22.40 kDa
protein length
164 aa Sequence Blast
gene length
495 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqfM

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,603,373 2,603,867

    The protein

    Protein family

  • UPF0178 family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|398924959D6C82918617C4B050F72D5E78EE12E9|yqxD]-[gene|F7B53E8AC92DAD15544C6208C2A5B41BABA73D6D|dnaG]-[gene|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]
    description
    [Pubmed|3298998]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3298998], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|3127379], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • enzymatic activity is inhibited by (p)ppGpp during the 'stringent response
  • additional information

  • An [SW|ncRNA|antisense RNA] is predicted for [gene|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA] [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C491 (yqxD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2489 NBRP B. subtilis, Japan]
  • BKE25230 ([gene|398924959D6C82918617C4B050F72D5E78EE12E9|yqxD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAACTCCTGCATAAAA, downstream forward: _UP4_TAAAGCATCGAATAATGTAC
  • BKK25230 ([gene|398924959D6C82918617C4B050F72D5E78EE12E9|yqxD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAACTCCTGCATAAAA, downstream forward: _UP4_TAAAGCATCGAATAATGTAC
  • References

  • 3298998,10411753,3127379