SubtiBank SubtiBank
efeB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

efeB

elemental iron uptake system, heme peroxidase, converts ferrous iron (Fe(II) to ferric iron (FeIII)) for uptake by [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO]-[protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU], peroxide detoxification under microaerobic conditions
locus
BSU38260
pI
8.64
mw
45.53 kDa
protein length
416 aa Sequence Blast
gene length
1251 bp Sequence Blast
function
ferrous iron conversion
product
heme peroxidase in elemental iron uptake
essential
no
ec
1.11.1.-
synonyms
ipa-29d,ywbN

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.2|Elemental iron transport system]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.5|Elemental iron transport system]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,926,682 3,927,932

    The protein

    Catalyzed reaction/ biological activity

  • oxidizes ferrous iron to ferric iron for uptake by [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO]-[protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] [Pubmed|23764491]
  • eliminates reactive oxygen species that accumulate in the presence of ferrous iron [Pubmed|23764491]
  • peroxide detoxification under microaerobic conditions [Pubmed|23764491]
  • Protein family

  • DyP-type peroxidase family (according to Swiss-Prot)
  • [SW|Cofactors]

  • protoheme IX [Pubmed|23764491]
  • Effectors of protein activity

  • activity is increased in the presence of [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO] due to the displacement of ferric iron [Pubmed|23764491]
  • Structure

  • [PDB|2Y4F] (from ''E. coli'', 38% identity)
  • [SW|Localization]

  • extracellular, secreted by the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] complex [Pubmed|15554971]
  • [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY]-dependent export of [protein|3985F88334D7B034A66473C5BB39188AB61A65F6|EfeB] requires a functional [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] [Pubmed|23180473]
  • forms a membrane-bound complex with [protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] and [protein|B31884DC49684A276D65E21A5F59AFDADEB9749C|EfeO] for iron uptake [Pubmed|23180473,23764491]
  • attached to the membrane via [protein|3BED98E311EF380AE77327C7F0A83254805089C0|EfeU] [Pubmed|23764491]
  • Expression and Regulation

    Operons

    genes
    [gene|3BED98E311EF380AE77327C7F0A83254805089C0|efeU]-[gene|B31884DC49684A276D65E21A5F59AFDADEB9749C|efeO]-[gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23764491], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    genes
    [gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]-[gene|65FC8F21D8927C231B55E8693BD29F052A830AF6|ywbO]
    description
    [Pubmed|18179421]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced upon iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B228 (ywbN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1227 NBRP B. subtilis, Japan]
  • BKE38260 ([gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTTACAAAACTCCT, downstream forward: _UP4_TAAAAGAAGCCTTTACAGGC
  • BKK38260 ([gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTTACAAAACTCCT, downstream forward: _UP4_TAAAAGAAGCCTTTACAGGC
  • labs

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • References

    Reviews

  • 24140208
  • Original publications

  • 16672620,19180538,12354229,19383693,9353933,9683469,15554971,21479178,18179421,22923395,23180473,23560556,23764491,23820555,24620988,18931290,26239117,27795321,29133393