SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


22.09 kDa
protein length
190 aa Sequence Blast
gene length
573 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,235,912 1,236,484

    The protein


  • CYTH domain (aa 4-189) (according to UniProt)
  • Modification

  • phosphorylated on Ser-2 [Pubmed|20509597]
  • Structure

  • [PDB|3SY3] (from ''B. anthracis'', 49% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B157 (yjbK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11580 ([gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCTCTTCCTTTCCG, downstream forward: _UP4_TAAGGTGGAATGACATCGTG
  • BKK11580 ([gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCTCTTCCTTTCCG, downstream forward: _UP4_TAAGGTGGAATGACATCGTG
  • References

  • 20509597,16522181