SubtiBank SubtiBank
yjbK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjbK

unknown
locus
BSU_11580
pI
5.88
mw
22.09 kDa
protein length
190 aa Sequence Blast
gene length
573 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,235,912 1,236,484

    The protein

    Modification

  • phosphorylated on Ser-2 [Pubmed|20509597]
  • Structure

  • [PDB|3SY3] (from ''B. anthracis'', 49% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]-[gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B157 (yjbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1156 NBRP B. subtilis, Japan]
  • BKE11580 ([gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCTCTTCCTTTCCG, downstream forward: _UP4_TAAGGTGGAATGACATCGTG
  • BKK11580 ([gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCTCTTCCTTTCCG, downstream forward: _UP4_TAAGGTGGAATGACATCGTG
  • References

  • 20509597,16522181