SubtiBank SubtiBank
yjbK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjbK

unknown
locus
BSU11580
pI
5.88
mw
22.09 kDa
protein length
190 aa Sequence Blast
gene length
573 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,235,912 1,236,484

    The protein

    Modification

  • phosphorylated on Ser-2 [Pubmed|20509597]
  • Structure

  • [PDB|3SY3] (from ''B. anthracis'', 49% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]-[gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B157 (yjbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1156 NBRP B. subtilis, Japan]
  • BKE11580 ([gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCTCTTCCTTTCCG, downstream forward: _UP4_TAAGGTGGAATGACATCGTG
  • BKK11580 ([gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCTCTTCCTTTCCG, downstream forward: _UP4_TAAGGTGGAATGACATCGTG
  • References

  • 20509597,16522181