SubtiBank SubtiBank
apt
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

apt

adenine phosphoribosyltransferase, universally conserved protein
locus
BSU_27610
pI
4.70
mw
18.73 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
function
purine salvage and interconversion
product
adenine phosphoribosyltransferase
essential
no
ec
2.4.2.7
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.5|Universally conserved proteins]
  • Gene

    Coordinates
    2,822,901 2,823,413

    The protein

    Catalyzed reaction/ biological activity

  • AMP + diphosphate --> 5-phospho-α-D-ribose 1-diphosphate + adenine (according to UniProt)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-85 [Pubmed|22517742]
  • Structure

  • [PDB|2DY0] (from ''Escherichia coli k12'', 56% identity, 66% similarity)
  • Additional information

  • [SW|universally conserved protein]
  • Expression and Regulation

    Operons

    genes
    [gene|BA755FA1CB1E0C006E9A23489A7C8997141AA498|recJ]-[gene|38DF74800FC5D54183C58B0EB82BD9A3EB93EE33|apt]
    description
    [Pubmed|15241682]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • BKE27610 ([gene|38DF74800FC5D54183C58B0EB82BD9A3EB93EE33|apt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATTGTTTTAAATCCATCT, downstream forward: _UP4_TAAGGATAACCGCATAACGA
  • BKK27610 ([gene|38DF74800FC5D54183C58B0EB82BD9A3EB93EE33|apt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTATTGTTTTAAATCCATCT, downstream forward: _UP4_TAAGGATAACCGCATAACGA
  • References

  • 3110131,15241682,22517742