SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


aminotransferase, legionaminic acid synthesis
43.03 kDa
protein length
389 aa Sequence Blast
gene length
1170 bp Sequence Blast
legionaminic acid synthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of legionaminic acid (for spore crust))]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,889,732 3,890,901

    Phenotypes of a mutant

  • less hydrophobic spore surface [pubmed|32817102]
  • The protein

    Catalyzed reaction/ biological activity

  • legionaminic acid synthesis [pubmed|32817102]
  • Protein family

  • DegT/DnrJ/EryC1 family (with [protein|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|EpsN] and [protein|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|NtdA], according to UniProt)
  • [SW|Cofactors]

  • PLP [pubmed|12429098]
  • Structure

  • [PDB|1MDX] (ArnB from Salomonella typhimurium, 44% identity) [pubmed|12429098]
  • [SW|Localization]

  • binds the outer surface of the forming spore [Pubmed|14602648]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • CS218 (''[gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE37890 ([gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTGCGCTCCTATC, downstream forward: _UP4_GATATCGTAAAAGGGGCTGA
  • BKK37890 ([gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTTGCGCTCCTATC, downstream forward: _UP4_GATATCGTAAAAGGGGCTGA
  • References

  • 9353933,15383836,14602648,25239894,26577401,27197833,12429098,32817102