SubtiBank SubtiBank
exoA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

exoA

apurinic/apyrimidinic endonuclease, multifunctional DNA-repair enzyme, important for spore dormance
locus
BSU_40880
pI
4.59
mw
29.10 kDa
protein length
252 aa Sequence Blast
gene length
759 bp Sequence Blast
function
repair of oxidative DNA damage in spores
product
apurinic/apyrimidinic endonuclease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.2|A/P endonucleases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    4,197,780 4,198,538

    Phenotypes of a mutant

  • an ''[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] [gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]'' double mutant is impaired in germination and spore outgrowth due to the accumulation of DNA lesions, this can be rescued by inactivation of ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]'' [Pubmed|24244006]
  • an ''[gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] [gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]'' double mutant is sensitive to radiation [Pubmed|24123749]
  • sensitive to blue light-induced DNA damage [pubmed|30054368]
  • The protein

    Catalyzed reaction/ biological activity

  • Exonucleolytic cleavage in the 3'- to 5'-direction to yield nucleoside 5'-phosphates (according to UniProt)
  • Protein family

  • DNA repair enzymes AP/ExoA family (single member, according to UniProt)
  • Structure

  • [PDB|5CFE] [Pubmed|27343627]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]-[gene|C14B113B1A8BEA0547459AA7EC5755634D1A8A88|ccpB]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/exoA-ccpA.html DBTBS]) null

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16237020], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16237020]
  • view in new tab

    Biological materials

    Mutant

  • GP898 (''exoA''::''kan''), available in [SW|Jörg Stülke]'s lab
  • GP1503 (''exoA''::''kan'', [gene|3C8BA04BA2BD0FEA28E99DA39BEB710CE3F5922D|nfo]::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE40880 ([gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT, downstream forward: _UP4_TGATGAGATAGCAGTAAGGA
  • BKK40880 ([gene|38CC84343C47CBF37F007E9056A9248869C396E1|exoA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCTCCCCCCT, downstream forward: _UP4_TGATGAGATAGCAGTAAGGA
  • References

    Reviews

  • 22933559
  • Original publications

  • 24244006,18203828,16237020,19930460,10540738,21441501,24123749,24123749,24914186,27343627,30054368,30726292