SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


31.03 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
peptidoglycan precursor biosynthesis
D-alanine aminotransferase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/acquisition of L- and D-alanine]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • Gene

    1,041,994 1,042,842

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + D-alanine --> D-glutamate + pyruvate (according to UniProt)
  • Protein family

  • [SW|Class-IV pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1G2W] (E177S Mutant, Geobacillus stearothermophilus, 43% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B489 (yheM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09670 ([gene|38989B6CB025AE110709E2EA2025EFD425328FFA|dat]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGCCCTCCCTTTTC, downstream forward: _UP4_TAAATGAACGAAGAAAAGAG
  • BKK09670 ([gene|38989B6CB025AE110709E2EA2025EFD425328FFA|dat]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGCCCTCCCTTTTC, downstream forward: _UP4_TAAATGAACGAAGAAAAGAG
  • References

  • 9003455,17183219