SubtiBank SubtiBank
dat
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dat

locus
BSU_09670
pI
4.87
mw
31.03 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
function
peptidoglycan precursor biosynthesis
product
D-alanine aminotransferase
essential
no
ec
2.6.1.21
synonyms
yheM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • Gene

    Coordinates
    1,041,994 1,042,842

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + D-alanine --> D-glutamate + pyruvate (according to UniProt)
  • Protein family

  • [SW|Class-IV pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1G2W] (E177S Mutant, Geobacillus stearothermophilus, 43% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|38989B6CB025AE110709E2EA2025EFD425328FFA|dat]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B489 (yheM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1488 NBRP B. subtilis, Japan]
  • BKE09670 ([gene|38989B6CB025AE110709E2EA2025EFD425328FFA|dat]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGCCCTCCCTTTTC, downstream forward: _UP4_TAAATGAACGAAGAAAAGAG
  • BKK09670 ([gene|38989B6CB025AE110709E2EA2025EFD425328FFA|dat]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAGCCCTCCCTTTTC, downstream forward: _UP4_TAAATGAACGAAGAAAAGAG
  • References

  • 9003455,17183219