SubtiBank SubtiBank
msrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

msrA

peptide methionine sulfoxide reductase
locus
BSU_21690
pI
5.71
mw
20.04 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast
function
regeneration of methionine and restoration of protein function after oxidative damage
product
peptide methionine sulfoxide reductase
essential
no
ec
1.8.4.11
synonyms
yppP

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,287,529 2,288,062

    The protein

    Catalyzed reaction/ biological activity

  • [thioredoxin]-disulfide + H2O + L-methionyl-[protein] --> [thioredoxin]-dithiol + L-methionyl-(S)-S-oxide-[protein](according to UniProt)
  • [thioredoxin]-disulfide + H2O + L-methionine --> [thioredoxin]-dithiol + L-methionine (S)-S-oxide (according to UniProt)
  • Protein family

  • MsrA Met sulfoxide reductase family (single member, according to UniProt)
  • Structure

  • [PDB|2GT3] (from E. coli, 45% identity) [pubmed|17157315]
  • Expression and Regulation

    Operons

    genes
    [gene|389245FDE13226D65DF117E28B5DA346DC856860|msrA]-[gene|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB]
    description
    [Pubmed|18662407]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18662407,17289755], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, oxidized [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] binds [protein|5996A5C25E108A3C4562686BF34A59CB14FD56EB|RpoA] and enhances [protein|389245FDE13226D65DF117E28B5DA346DC856860|MsrA]-[protein|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|MsrB] operon transcription [Pubmed|18662407], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by oxidative stress ([protein|search|Spx])
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A894 (yppP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/894 NBRP B. subtilis, Japan]
  • BKE21690 ([gene|389245FDE13226D65DF117E28B5DA346DC856860|msrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGGTGCCTCCTTTGT, downstream forward: _UP4_TAAATGGCGTACAATAAAGA
  • BKK21690 ([gene|389245FDE13226D65DF117E28B5DA346DC856860|msrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTGGTGCCTCCTTTGT, downstream forward: _UP4_TAAATGGCGTACAATAAAGA
  • References

  • 18662407,17157315