SubtiBank SubtiBank
lnrK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lnrK

two-component response regulator, involved in resistance to linearmycin
locus
BSU08300
pI
4.67
mw
24.22 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
function
resistance to linearmycin
product
two-component response regulator
essential
no
synonyms
yfiK

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    905,010 905,672

    The protein

    Paralogous protein(s)

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR], [protein|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|YhcZ], [protein|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI], [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|YxjL]
  • Modification

  • phosphorylated by [protein|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|LnrJ] on an Asp residue
  • Structure

  • [PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 42% identity) [pubmed|27670715]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|lnrJ]-[gene|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]
    description
    [Pubmed|8973323]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C301 (yfiK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2299 NBRP B. subtilis, Japan]
  • BKE08300 ([gene|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTCGGTAATGATGATCT, downstream forward: _UP4_TGACATATGACGTTTTGCAT
  • BKK08300 ([gene|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTCGGTAATGATGATCT, downstream forward: _UP4_TGACATATGACGTTTTGCAT
  • References

  • 10094672,8973323,26647299,28461449,27670715