SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional antiterminator of the glpT-glpQ and glpF-glpK-glpD operons
21.46 kDa
protein length
192 aa Sequence Blast
gene length
579 bp Sequence Blast
regulation of glycerol and glycerol-3-phosphate utilization
transcriptional antiterminator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of phospholipids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • Gene

    1,001,744 1,002,322

    The protein


  • [PDB|3KTS] (from Listeria monocytogenes, 49% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21925382], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • half-life of the mRNA: 3.7 min [PubMed|21925382]
  • half-life of the mRNA: 3.7 min [PubMed|21925382]
  • view in new tab

    Biological materials


  • BKE09270 ([gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGCTCCTTTAATAATT, downstream forward: _UP4_TGACACCGCTTTCATGCACT
  • BKK09270 ([gene|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGCTCCTTTAATAATT, downstream forward: _UP4_TGACACCGCTTTCATGCACT
  • labs

  • [SW|Josef Deutscher], Paris-Grignon, France
  • References

  • 8825777,11929549,8436953,9595668,9493382,1479885,1809833,182672,21925382