SubtiBank SubtiBank
yqeW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeW

putative sodium-dependent phosphate transporter
locus
BSU25420
pI
9.69
mw
33.25 kDa
protein length
307 aa Sequence Blast
gene length
924 bp Sequence Blast
function
phosphate uptake
product
putative phosphate transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.8|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,620,717 2,621,640

    Expression and Regulation

    Operons

    genes
    [gene|3856602E9FBCF23869F181CE75D92C9570A651CF|yqeW]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C495 (yqeW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2493 NBRP B. subtilis, Japan]
  • BKE25420 ([gene|3856602E9FBCF23869F181CE75D92C9570A651CF|yqeW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTATTCACCAACCCCT, downstream forward: _UP4_TAAAAAAATCGGTACATTTT
  • BKK25420 ([gene|3856602E9FBCF23869F181CE75D92C9570A651CF|yqeW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTATTCACCAACCCCT, downstream forward: _UP4_TAAAAAAATCGGTACATTTT