SubtiBank SubtiBank
yqeW
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqeW

putative sodium-dependent phosphate transporter
locus
BSU_25420
pI
9.69
mw
33.25 kDa
protein length
307 aa Sequence Blast
gene length
924 bp Sequence Blast
function
phosphate uptake
product
putative phosphate transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.8|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,620,717 2,621,640

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3856602E9FBCF23869F181CE75D92C9570A651CF|yqeW]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C495 (yqeW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2493 NBRP B. subtilis, Japan]
  • BKE25420 ([gene|3856602E9FBCF23869F181CE75D92C9570A651CF|yqeW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTATTCACCAACCCCT, downstream forward: _UP4_TAAAAAAATCGGTACATTTT
  • BKK25420 ([gene|3856602E9FBCF23869F181CE75D92C9570A651CF|yqeW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTATTCACCAACCCCT, downstream forward: _UP4_TAAAAAAATCGGTACATTTT