SubtiBank SubtiBank
spoVS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spoVS

required for dehydratation of the spore core and assembly of the coat, mutation increases [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression, might act via [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]
locus
BSU_16980
pI
6.47
mw
8.66 kDa
protein length
gene length
261 bp Sequence Blast
function
spore coat assembly, spore core dehydratation
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    Coordinates
    1,769,935 1,770,195

    Phenotypes of a mutant

  • increased [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression, this might occur via [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|16428420]
  • The protein

    Structure

  • [PDB|2EK0] (from ''Thermus thermophilus'', 56% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]
    description
    [Pubmed|7559352]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|7559352], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • expressed at the onset of stationary phase ([protein|search|SigH]) [Pubmed|7559352]
  • view in new tab

    Biological materials

    Mutant

  • GP1601 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::cat), available in [SW|Jörg Stülke]'s lab
  • GP1848 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]-[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::''spc'' cassette), available in [SW|Jörg Stülke]'s lab
  • BKE16980 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT, downstream forward: _UP4_TAAAAACAAATAAAGCATTC
  • BKK16980 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT, downstream forward: _UP4_TAAAAACAAATAAAGCATTC
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 7559352,18562273,16428420,20525796