SubtiBank SubtiBank
spoVS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoVS

required for dehydratation of the spore core and assembly of the coat, mutation increases [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression, might act via [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]
locus
BSU_16980
pI
6.47
mw
8.66 kDa
protein length
gene length
261 bp Sequence Blast
function
spore coat assembly, spore core dehydratation
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    Coordinates
    1,769,935 1,770,195

    Phenotypes of a mutant

  • increased [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]-dependent gene expression, this might occur via [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|16428420]
  • The protein

    Structure

  • [PDB|2EK0] (from ''Thermus thermophilus'', 56% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]
    description
    [Pubmed|7559352]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|7559352], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • expressed at the onset of stationary phase ([protein|search|SigH]) [Pubmed|7559352]
  • view in new tab

    Biological materials

    Mutant

  • GP1601 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::cat), available in [SW|Jörg Stülke]'s lab
  • GP1848 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]-[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::''spc'' cassette), available in [SW|Jörg Stülke]'s lab
  • BKE16980 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT, downstream forward: _UP4_TAAAAACAAATAAAGCATTC
  • BKK16980 ([gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTGCTCCCCCTTAGT, downstream forward: _UP4_TAAAAACAAATAAAGCATTC
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 7559352,18562273,16428420,20525796