SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


PBSX prophage
34.46 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,329,555 1,330,490

    The protein


  • extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12610 ([gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGATTTCCTCCTCCTT, downstream forward: _UP4_TAATAGAAACGAGGTGGTCA
  • BKK12610 ([gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGATTTCCTCCTCCTT, downstream forward: _UP4_TAATAGAAACGAGGTGGTCA
  • References

  • 2110147,8083174,18957862