SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|cell division] inhibitor (septum placement), part of the Min system (with Z ring placement)
29.26 kDa
protein length
268 aa Sequence Blast
gene length
807 bp Sequence Blast
septum placement
[SW|cell division] inhibitor

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|The Min system]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,857,776 2,858,582

    Phenotypes of a mutant

  • a ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]-[gene|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD]'' mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
  • The protein

    Catalyzed reaction/ biological activity

  • The Min system prevents minicell formation adjacent to recently completed division sites by promoting the disassembly of the cytokinetic ring, thereby ensuring that cell division occurs only once per cell cycle [Pubmed|20352045]
  • required for oriC placement during spore development [Pubmed|27059541]
  • Protein family

  • ParA family (with [protein|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|FlhG] and [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA], according to UniProt)
  • Structure

  • [PDB|4V03] (from ''Aquifex aeolicus'', 51% identity) [Pubmed|25500731]
  • [SW|Localization]

  • polar/ septal at the cell membrane [Pubmed|20566861]
  • membrane binding/ polar localization depends on the proton motive force [Pubmed|20566861]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, promoter p1, upstream of [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|26091431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, promoter p2, within [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, promoter p4, upstream of [protein|8C94C9598A823A8405B3E1FA0124E21D90845B8E|MinC] [Pubmed|8459776], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|26091431], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab



  • constitutively expressed [Pubmed|23701187]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, promoter p2 within [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, promoter p1, upstream of [protein|49D996C9AED44A820A214C3DF60AB1B6E1508DEA|Maf] [Pubmed|26091431], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817,21564336], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials


  • BKE27990 ([gene|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTATTACGATAGCCTCAC, downstream forward: _UP4_TAATGTGATAGAATCAAAGA
  • BKK27990 ([gene|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTTATTACGATAGCCTCAC, downstream forward: _UP4_TAATGTGATAGAATCAAAGA
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References


  • 26286503,19884039,24367361,28697666
  • Original Publications

  • 8459776,19019154,11886553,9808628,1400224,12368265,10411726,15317782,12492861,20352045,11886553,20566861,18179421,21821766,22457634,21926231,24097947,25374563,25500731,22383849,26091431,27059541,28674273,30092000